Prev. | 

RIKEN DNA Bank Human Resource - SAAL1

Gene ID NCBI Gene 113174 |  KEGG hsa:113174
Gene Symbol SAAL1
Protein Name serum amyloid A like 1
Synonyms SPACIA1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326878 RBb17D06 pKA1U5 NM_138421.2  
GCCGGCACGGCCTTCAAGCGCGGGACGCGACAAAGTCATGGACCGCAACCCCTCGCCGCC
HKR405348 RBdS013G04 pGCAP10 NM_138421.2  
GCTTCAAGCGCGGGACGCGACAAAGTCATGGACCGCAACCCCTCGCCGCCGCCGCCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl