Prev. |  KEGG KO K17390 > 

RIKEN DNA Bank Human Resource - CDCA5

Gene ID NCBI Gene 113130 |  KEGG hsa:113130
Gene Symbol CDCA5
Protein Name cell division cycle associated 5
Synonyms SORORIN
Ortholog resource in our bank

  CDCA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090077 IRAL025D05 pOTB7 BC011000 NM_080668

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099221 M01C048A21 pDONR221 MGC13-E11 BC011000 NM_080668 done
HGE099269 M01C048C21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099317 M01C048E21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099365 M01C048G21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099413 M01C048I21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099461 M01C048K21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099509 M01C048M21 pDONR221 MGC13-E11 BC011000 NM_080668  
HGE099557 M01C048O21 pDONR221 MGC13-E11 BC011000 NM_080668  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331650 RBb29C02 pGCAP1 NM_080668.3  
GCTTCCCGGTTGGCGCGCGCCCGGGGCGGCGGCGCTGGAGGAGCTCGAGACGGAGCCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl