Prev. |  KEGG KO K05857 > 

RIKEN DNA Bank Human Resource - PLCD3

Gene ID NCBI Gene 113026 |  KEGG hsa:113026
Gene Symbol PLCD3
Protein Name phospholipase C delta 3
Synonyms PLC-delta-3
Ortholog resources KEGG ortholog (KEGG orthology K05857) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005231 IRAK013B07 pCMV-SPORT6 BC010668 NM_133373 Partial
HGY100309 IRAL050M21 pOTB7 BC072384 NM_133373 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168858 ARi22C10 pGCAP10 NM_133373.3  
GGCGCCGCTAAGTTTCTTCGCTCGCCGCCTCGCTCAGAGCCGGGGCCGGGCCAGAGCGGC
HKR187326 ARi68F06 pGCAP10 NM_133373.3  
GAGAGCCGGGGCCGGGCCCGAGCGGCGCCCCGCTGCCGGGGACCTCNANCCGCTGAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl