Prev. | 

RIKEN DNA Bank Human Resource - FDX2

Gene ID NCBI Gene 112812 |  KEGG hsa:112812
Gene Symbol FDX2
Protein Name ferredoxin 2
Synonyms FDX1L|MEOAL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035835 IRAK089J19 pCMV-SPORT6 BC044225 NM_080665 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049602 ARe24A02 pKA1U5 NM_001031734.2  
GAGGCTCGCGCCCGGCTGGAGAGGAGGACGCGGGCGGCCCGGAGCGGCCCGGGGACGTGG
HKR171630 ARi29B06 pGCAP10 NM_001031734.2  
GGGGGAGGGGGTGGCGCTGGGGACAACCAGAAAGTTTCAAGCGACAGGCTCGCGCCCGGC
HKR335650 RBb39C02 pGCAP1 NM_001031734.2  
GGGAGAGGAGGACGCGGGCGGCCCGGAGCGGCCCGGGGACGTGGTGAACGTGGTGTTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl