Prev. | 

RIKEN DNA Bank Human Resource - GLMP

Gene ID NCBI Gene 112770 |  KEGG hsa:112770
Gene Symbol GLMP
Protein Name glycosylated lysosomal membrane protein
Synonyms C1orf85|NCU-G1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020189 IRAK050H21 pCMV-SPORT6 BC036340 NM_144580 Partial/var
HGY091857 IRAL029K17 pOTB7 BC011575 NM_144580 Full
HGY096206 IRAL040I14 pOTB7 BC018757 NM_144580

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR123302 ARh08E06 pGCAP1 NM_144580.1  
GCTGGCACCTCTTCCGTCGGCTGAATTGCGGCCGTATGCGCGGCTCTGTGGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl