Prev. | 

RIKEN DNA Bank Human Resource - CMTM7

Gene ID NCBI Gene 112616 |  KEGG hsa:112616
Gene Symbol CMTM7
Protein Name CKLF like MARVEL transmembrane domain containing 7
Synonyms CKLFSF7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090962 IRAL027G18 pOTB7 BC010116 NM_181472 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004178 W01A010H10 pENTR-TOPO IRAL027G18 BC010116 NM_181472  
HGE004180 W01A010H12 pENTR-TOPO IRAL027G18 BC010116 NM_181472  
HGE004182 W01A010H14 pENTR-TOPO IRAL027G18 BC010116 NM_181472  
HGE004184 W01A010H16 pENTR-TOPO IRAL027G18 BC010116 NM_181472  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064802 ARe62A02 pKA1U5 NM_138410.2  
GAGTCTAACTTCCGCGCATCTACGAGGGCCGGGACTGCCGCTACCTTTCTGGAAGGCGCC
HKR260290 ARiS150M02 pGCAP10 NM_138410.2  
GGAGGCGGCCNGCGAGCTGGGGCCGCGCAATGTCGCACGGAGCCGGGCTCGTCCGCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl