Prev. |  KEGG KO K18417 > 

RIKEN DNA Bank Human Resource - ERI2

Gene ID NCBI Gene 112479 |  KEGG hsa:112479
Gene Symbol ERI2
Protein Name ERI1 exoribonuclease family member 2
Synonyms EXOD1|ZGRF5
Ortholog resource in our bank

  ERI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007761 IRAK019G17 pCMV-SPORT6 BC010503 NM_080663

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092041 M01C030B17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092089 M01C030D17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092137 M01C030F17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092185 M01C030H17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092233 M01C030J17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092281 M01C030L17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092329 M01C030N17 pDONR221 MGC04-G09 BC010503 ENST00000300005  
HGE092377 M01C030P17 pDONR221 MGC04-G09 BC010503 ENST00000300005  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR399747 RBd99G03 pGCAP10 NM_080663.1  
GACTTGGAAAAGCAAGGAGTGTCGGGAATGGCGACCAAGCGGCTCGCGCGGCAGCTTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl