Prev. | 

RIKEN DNA Bank Human Resource - CAVIN3

Gene ID NCBI Gene 112464 |  KEGG hsa:112464
Gene Symbol CAVIN3
Protein Name caveolae associated protein 3
Synonyms HSRBC|PRKCDBP|SRBC|cavin-3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011531 IRAK028N19 pCMV-SPORT6 BC038387 NM_145040 Full/var
HGY091811 IRAL029I19 pOTB7 BC011585 NM_145040 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100412 M01C051A12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100460 M01C051C12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100508 M01C051E12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100556 M01C051G12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100604 M01C051I12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100652 M01C051K12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100700 M01C051M12 pDONR221 MGC15-B06 BC011585 NM_145040  
HGE100748 M01C051O12 pDONR221 MGC15-B06 BC011585 NM_145040  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR123702 ARh09E06 pGCAP1 NM_145040.2  
GAGACGGAGCAGAGCGGTCAGGGATCATGAGGGAGAGTGCGTTGGAGCCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl