Prev. |  KEGG KO K09592 > 

RIKEN DNA Bank Human Resource - EGLN2

Gene ID NCBI Gene 112398 |  KEGG hsa:112398
Gene Symbol EGLN2
Protein Name egl-9 family hypoxia inducible factor 2
Synonyms EIT-6|EIT6|HIF-PH1|HIFPH1|HPH-1|HPH-3|PHD1
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  EGLN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019218 IRAK048A18 pBluescriptR BC036051 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044457 ARe11C09 pKA1U5 NM_053046.2  
GGCGCTGTGCGGCGCAGGGCGGCTGGCACAAACNGCGGCGCCGGGGCCGGAGGAAAAAGC
HKR205498 ARiS013M10 pGCAP10 NM_053046.2  
GGGGGCGGGGCGTCGCGCGCGGTGGGGGCGGGGTATGGCGCGCTGTGCGGCGCAGGGCGG
HKR249068 ARiS122L04 pGCAP10 NM_053046.2  
GGGGGCGTCGCGCGCGGTGGGGGCGGGGTATGGCGCGCTGTGCGGCGCAGGGCGGCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl