Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AZ2

Gene ID NCBI Gene 94239 |  KEGG hsa:94239
Gene Symbol H2AZ2
Protein Name H2A.Z variant histone 2
Synonyms H2A.Z-2|H2AFV|H2AV
Ortholog resource in our bank

  H2AZ2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006034 IRAK015B10 pCMV-SPORT6 BC014885 NM_201516 Full
HGY083079 IRAL007L15 pOTB7 BC000098 NM_201516 Full
HGY085325 IRAL013F05 pOTB7 BC004274 NM_201516 Full
HGY103036 IRAL057J20 pDNR-LIB BC070169 NM_201516 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077303 ARe93E07 pKA1U5 NM_012412.4  
GATTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTC
HKR179778 ARi49H10 pGCAP10 NM_012412.4  
GATTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTC
HKR181322 ARi53F02 pGCAP10 NM_012412.4  
GGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGCGGAGGCGG
HKR203519 ARiS008N07 pGCAP10 NM_012412.4  
TGGATTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGG
HKR218098 ARiS045E02 pGCAP10 NM_012412.4  
GAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGCGGAGGCGGAGT
HKR247208 ARiS118A08 pGCAP10 NM_012412.4  
GGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGC
HKR264408 ARiS161A08 pGCAP10 NM_012412.4  
GAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGCGGAGGCGGAGT
HKR362552 RBd06G08 pGCAP10 NM_012412.4  
GGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGC
HKR378809 RBd47A09 pGCAP10 NM_012412.4  
GGGCGGCGGAGTCGGCGCCGAGAACATGTTTCCTGTGGGCCGCATCCACAGACACTTGAA
HKR384425 RBd61B01 pGCAP10 NM_012412.4  
GATTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTC
HKR386458 RBd66C10 pGCAP10 NM_012412.4  
GACGNNNTNTTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGC
HKR389627 RBd74B03 pGCAP10 NM_012412.4  
CGGCCGGCCGATGGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCC
HKR391301 RBd78E05 pGCAP10 NM_012412.4  
GGGGGTATTGNCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGC
HKR394930 RBd87F10 pGCAP10 NM_012412.4  
GAAGCGGGCATTGGCCACAGCAGCGCGAGGCGGGCACGGGGTATTGTCCGGCTCCGGCGG
HKR442258 RBdS105K18 pGCAP10 NM_012412.4  
GGCTGCGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl