Prev. |  KEGG KO K17598 > 

RIKEN DNA Bank Human Resource - SYTL3

Gene ID NCBI Gene 94120 |  KEGG hsa:94120
Gene Symbol SYTL3
Protein Name synaptotagmin like 3
Synonyms SLP3
Ortholog resource in our bank

  SYTL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235335 ARiS088F15 pGCAP10 NM_001009991.2  
GGAGGTGGTAGTTTCCATGGGAATCCGTGAGGGTAGCCGGGCAGCTCCCTAAACCTTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl