Prev. | 

RIKEN DNA Bank Human Resource - ORMDL3

Gene ID NCBI Gene 94103 |  KEGG hsa:94103
Gene Symbol ORMDL3
Protein Name ORMDL sphingolipid biosynthesis regulator 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008273 IRAK020L09 pCMV-SPORT6 BC017087 NM_139280 Full
HGX044021 IRAK110A21 pCMV-SPORT6 BC050710 NM_139280 Partial/var
HGX047606 IRAK119A06 pCMV-SPORT6 BC054042 NM_139280
HGY082137 IRAL005F17 pOTB7 BC000638 NM_139280 Partial/var
HGY103489 IRAL058M01 pOTB7 BC071833 NM_139280 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074900 ARe87E04 pKA1U5 NM_139280.1  
GGTTCCCGGGCCGTTGATCTTCGGCCCCACACCAACNNCAGAGAGGGGCAGCAGGATGAA
HKR322576 RBb06H08 pKA1U5 NM_139280.1  
GACAGCTGCTGGAGCAGCAGCGGCCCCCGCTCCCGGGAACCGTTCCCGGGCCGTTGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl