Prev. |  KEGG KO K23503 > 

RIKEN DNA Bank Human Resource - SFXN5

Gene ID NCBI Gene 94097 |  KEGG hsa:94097
Gene Symbol SFXN5
Protein Name sideroflexin 5
Synonyms BBG-TCC|SLC56A5
Ortholog resource in our bank

  SFXN5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR461774 RBdS154H06 pGCAP10 NM_144579.2  
AGATTGCGGGCGTCAGTGGCCATGGCGGATACAGCGACTACAGCATCGGCGGCGGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl