Prev. |  KEGG KO K23500 > 

RIKEN DNA Bank Human Resource - SFXN1

Gene ID NCBI Gene 94081 |  KEGG hsa:94081
Gene Symbol SFXN1
Protein Name sideroflexin 1
Synonyms SLC56A1|TCC
Ortholog resource in our bank

  SFXN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008905 IRAK022E09 pCMV-SPORT6 BC020517 NM_022754 Partial
HGX044327 IRAK110N15 pCMV-SPORT6 BC063241 NM_022754

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037293 W01A093D21 pENTR-TOPO IRAK110N15 BC063241 NM_022754  
HGE037295 W01A093D23 pENTR-TOPO IRAK110N15 BC063241 NM_022754  
HGE037325 W01A093F05 pENTR-TOPO IRAK110N15 BC063241 NM_022754  
HGE037327 W01A093F07 pENTR-TOPO IRAK110N15 BC063241 NM_022754  
HGE046145 W01A115G01 pENTR-TOPO IRAK110N15 BC063241 NM_022754  
HGE046149 W01A115G05 pENTR-TOPO IRAK110N15 BC063241 NM_022754  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080811 ARf02A11 pKA1U5 NM_022754.5  
GAGCGTTTCCGGTGGCGGCGGAGGCTGCACTGAGCGGGACCTGCGAGCAGCGCGGGCGGC
HKR222002 ARiS055A02 pGCAP10 NM_022754.5  
GACTGAGCGGGACCTGCGAGCAGCGCGGGCGGCAGCCCGGGGGAAGCGTCCGGGACCATG
HKR370457 RBd26C09 pGCAP10 NM_022754.5  
GGGGATTATGNTTCCCGGTGGCGGCGNNNGCTGAACTGAGCGCCCCCTGGGAGCAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl