Prev. | 

RIKEN DNA Bank Human Resource - LENG9

Gene ID NCBI Gene 94059 |  KEGG hsa:94059
Gene Symbol LENG9
Protein Name leukocyte receptor cluster member 9
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091632 IRAL029B08 pOTB7 BC015921 NM_198988

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100415 M01C051A15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100463 M01C051C15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100511 M01C051E15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100559 M01C051G15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100607 M01C051I15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100655 M01C051K15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100703 M01C051M15 pDONR221 MGC15-A08 BC015921 NM_198988  
HGE100751 M01C051O15 pDONR221 MGC15-A08 BC015921 NM_198988  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046155 ARe15G11 pKA1U5 NM_198988.1  
GAGAGCAGCGGTGTCAGGCTCTCCACCAAGGAGGGACTGGGCCAGAGTCCTCGCGAGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl