Prev. | 

RIKEN DNA Bank Human Resource - MRFAP1

Gene ID NCBI Gene 93621 |  KEGG hsa:93621
Gene Symbol MRFAP1
Protein Name Morf4 family associated protein 1
Synonyms PAM14|PGR1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097152 IRAL042O16 pOTB7 BC022797 NM_033296 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123626 ARh09B02 pGCAP1 NM_033296.1  
GGTTCGCCGTTACTCTGCGCACATCGCTATTGCGGTTCCGAGGCAGTGGGAAGAGATGCG
HKR416312 RBdS040M24 pGCAP10 NM_033296.1  
GATTTTTTGTTCGCCGTTACTCTGCGCGTAAGTCGCTTGTCCGTGGCTTCTCTGAGAAGA
HKR453153 RBdS132O17 pGCAP10 NM_033296.1  
GATTTTTGTTCGCCGTTACTCTGCGCGTAAGTCGCTTGTCCGTGGCTTCTCTGAGAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl