Prev. | 

RIKEN DNA Bank Human Resource - MAPK1IP1L

Gene ID NCBI Gene 93487 |  KEGG hsa:93487
Gene Symbol MAPK1IP1L
Protein Name mitogen-activated protein kinase 1 interacting protein 1 like
Synonyms C14orf32|MISS|c14_5346
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093541 IRAL033O05 pOTB7 BC015621 NM_144578 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052977 ARe32H09 pKA1U5 NM_144578.3  
GGCCAGGAGGAGCCGCGCGCTGCTGGTGCTGTTGCCGCCGCTGCTCTAGCTGCCGTCAGT
HKR377299 RBd43E03 pGCAP10 NM_144578.3  
GAGGAGGAGCCGCGCGCTGCTGGTGCTGTTGCCGCCGCTGCTCTAGCTGCCGTCAGTCAG
HKR470901 RBdS177E05 pGCAP10 NM_144578.3  
GAGGAGGAGCCGCGCGCTGCTGGTGCTGTTGCCGCCGCTGCTCTAGCTGCCGTCAGTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl