Prev. |  KEGG KO K18588 > 

RIKEN DNA Bank Human Resource - COQ10A

Gene ID NCBI Gene 93058 |  KEGG hsa:93058
Gene Symbol COQ10A
Protein Name coenzyme Q10A
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K18588) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011834 IRAK029J18 pCMV-SPORT6 BC026922 NM_144576 Partial/var
HGY036659 IRAK091K19 pBluescript BC047444 NM_144576 Partial/var
HGX066604 IRAK166I12 pCMV-SPORT6 BC073923 NM_144576 Full/var
HGY082160 IRAL005G16 pOTB7 BC002435 NM_144576 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR347356 RBb68G12 pGCAP1 NM_144576.3  
TGGGGTCGCTGCGAACCCCGGGGTTCCGCGGTGGAGGGGTGCTATACTGGGATGCAGGCG
HKR428234 RBdS070J18 pGCAP10 NM_144576.3  
GGGTGACCGCGGCTGAGGGCAGGGGGTCGCTGCGAACCCCGGGGTTCCGCGGTGGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl