Prev. |  KEGG KO K18588 > 

RIKEN DNA Bank Human Resource - COQ10A

Gene ID NCBI Gene 93058 |  KEGG hsa:93058
Gene Symbol COQ10A
Protein Name coenzyme Q10A
Synonyms -
Ortholog resource in our bank

  COQ10A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011834 IRAK029J18 pCMV-SPORT6 BC026922 NM_144576 Partial/var
HGY036659 IRAK091K19 pBluescript BC047444 NM_144576 Partial/var
HGX066604 IRAK166I12 pCMV-SPORT6 BC073923 NM_144576 Full/var
HGY082160 IRAL005G16 pOTB7 BC002435 NM_144576 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347356 RBb68G12 pGCAP1 NM_144576.3  
TGGGGTCGCTGCGAACCCCGGGGTTCCGCGGTGGAGGGGTGCTATACTGGGATGCAGGCG
HKR428234 RBdS070J18 pGCAP10 NM_144576.3  
GGGTGACCGCGGCTGAGGGCAGGGGGTCGCTGCGAACCCCGGGGTTCCGCGGTGGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl