Prev. |  KEGG KO K16759 > 

RIKEN DNA Bank Human Resource - CCDC102A

Gene ID NCBI Gene 92922 |  KEGG hsa:92922
Gene Symbol CCDC102A
Protein Name coiled-coil domain containing 102A
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K16759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085566 IRAL013P06 pOTB7 BC008285 NM_033212 Full
HGY085448 IRAL013K08 pOTB7 BC004307 NM_033212 Partial
HGY086852 IRAL017C04 pOTB7 BC009941 NM_033212

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081225 M01C003B01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081273 M01C003D01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081321 M01C003F01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081369 M01C003H01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081417 M01C003J01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081465 M01C003L01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081513 M01C003N01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE081561 M01C003P01 pDONR221 04-134-2_2-C01 BC008285 ENST00000258214  
HGE098411 M01C046A11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098459 M01C046C11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098507 M01C046E11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098555 M01C046G11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098603 M01C046I11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098651 M01C046K11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098699 M01C046M11 pDONR221 MGC12-E06 BC008285 ENST00000258214  
HGE098747 M01C046O11 pDONR221 MGC12-E06 BC008285 ENST00000258214  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR192124 ARi80F04 pGCAP10 NM_033212.3  
GAGCTGCACGGTGCCCGCTCTACCCCGCCGCAGCGGCTGGGACGTACGGAGCCCGCAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl