Prev. |  KEGG KO K10582 > 

RIKEN DNA Bank Human Resource - UBE2Q2

Gene ID NCBI Gene 92912 |  KEGG hsa:92912
Gene Symbol UBE2Q2
Protein Name ubiquitin conjugating enzyme E2 Q2
Synonyms -
Ortholog resource in our bank

  UBE2Q2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001376 IRAK003H08 pCMV-SPORT6 BC006827 NM_173469
HGX009015 IRAK022I23 pCMV-SPORT6 BC017708 NM_173469

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE120029 M01C100B05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120077 M01C100D05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120125 M01C100F05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120173 M01C100H05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120221 M01C100J05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120269 M01C100L05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120317 M01C100N05 pDONR221 IMS13-G03 BC017708 NM_173469  
HGE120365 M01C100P05 pDONR221 IMS13-G03 BC017708 NM_173469  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080547 ARf01G03 pKA1U5 NM_173469.1  
GGCCGAGGCTTCCGCGCCCCTCGCCATTTTCCAGCAGCGCTCGACGAGGCGGAGCCGCGA
HKR183255 ARi58C07 pGCAP10 NM_173469.1  
GAGCGCTCGACGAGGCGGAGCCGCGAGAGCGCGGCCCAGGCCGGCCCCGCGGGGCGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl