Prev. | 

RIKEN DNA Bank Human Resource - SHKBP1

Gene ID NCBI Gene 92799 |  KEGG hsa:92799
Gene Symbol SHKBP1
Protein Name SH3KBP1 binding protein 1
Synonyms PP203|Sb1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089557 IRAL023O21 pOTB7 BC007653 NM_138392 Partial/var
HGY092903 IRAL032E07 pDNR-LIB BC022855 NM_138392 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078807 ARe97A07 pKA1U5 NM_138392.2  
GATCGCCCGGGGGCCATGGCAGCAGCGGCTACTGCATNCGAGGGGGTCCCCAGNTCGGGG
HKR209307 ARiS023E11 pGCAP10 NM_138392.2  
GACACCCGGNAGTGGGTGCGGGCCAGCCGGCTCGCCCGGGGGCCATGGCAGCAGCGGCTA
HKR326527 RBb16F07 pKA1U5 NM_138392.2  
GTCGCCCGGGGGCCATGGCAGCAGCGGCTACTGCAGCCGAGGGGGTCCCCAGTCGGGGGC
HKR420511 RBdS051E15 pGCAP10 NM_138392.2  
GGCCCGGGGGCCATGGCAGCAGCGGCTACTGCAGCCGAGGGGGTCCCCAGTCGGGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl