Prev. |  KEGG KO K14992 > 

RIKEN DNA Bank Human Resource - SLC38A5

Gene ID NCBI Gene 92745 |  KEGG hsa:92745
Gene Symbol SLC38A5
Protein Name solute carrier family 38 member 5
Synonyms JM24|SN2|SNAT5|pp7194
Ortholog resource in our bank

  SLC38A5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083173 IRAL007P13 pOTB7 BC019246 NM_033518 Full/var
HGY093355 IRAL033G11 pOTB7 BC027721 NM_033518 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162877 ARi07D05 pGCAP10 NM_033518.2  
GCCCCCTTCTTCAGCTCCCCTCACTTTGAAGCATGCTCGTTCCATCTCTGATCCCCCCAC
HKR362803 RBd07A03 pGCAP10 NM_033518.2  
GAGACAGCGTGAGTCTGGGGTCTGGGAGGAGAGGCTATCCCTTCTCCACGTGGTCGGCTC
HKR396577 RBd91H09 pGCAP10 NM_033518.2  
GGAATGAAAGACACAGATGGCAAGAGAGACAGCGATGGAACTGCAGGATCCAAAGATGAA
HKR408849 RBdS022C01 pGCAP10 NM_033518.2  
GGGAAAAAAAAAAAAGTACCGCTCCAGAGCAGGAGCCTAGGCAGCCGAGAGGGTGCCCGA
HKR442102 RBdS105E06 pGCAP10 NM_033518.2  
GGAGAGGGTGCCCGAACCTGAGTCTGAGTTGCGGCCACTTCAGGAGCTGAGAGGAGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl