Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARRDC1

Gene ID (NCBI) 92714
Gene Symbol ARRDC1
Protein Name arrestin domain containing 1
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025844 IRAK064K04 pCMV-SPORT6 BC032346 NM_152285 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093639 M01C034B15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093687 M01C034D15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093735 M01C034F15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093783 M01C034H15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093831 M01C034J15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093879 M01C034L15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093927 M01C034N15 pDONR221 MGC06-G08 BC032346 NM_152285  
HGE093975 M01C034P15 pDONR221 MGC06-G08 BC032346 NM_152285  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR179653 ARi49C05 pGCAP10 NM_152285.2  
GGGGGCCGGGCCTCGGAGCCGGGACTCGCGGGCGGCGGGCGGGGGCGTCGCTGCGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.09.08

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170829.pl