Prev. | 

RIKEN DNA Bank Human Resource - TMEM183A

Gene ID NCBI Gene 92703 |  KEGG hsa:92703
Gene Symbol TMEM183A
Protein Name transmembrane protein 183A
Synonyms C1orf37
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007622 IRAK019A22 pCMV-SPORT6 BC013073 NM_138391 Full/var
HGX033009 IRAK082I17 pCMV-SPORT6 BC038952 NM_138391 Full
HGY066880 IRAK167D08 pBluescriptR BC067775 NM_138391 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080952 ARf02G08 pKA1U5 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR173303 ARi33E07 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR203227 ARiS008B03 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGATCTC
HKR235518 ARiS088N06 pGCAP10 NM_138391.4  
TGGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCT
HKR235562 ARiS088P02 pGCAP10 NM_138391.4  
TGGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCT
HKR331609 RBb29A09 pGCAP1 NM_138391.4  
GGTGGCGGAGAGTTAGCGGCCTCCGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCT
HKR362482 RBd06D10 pGCAP10 NM_138391.4  
GAGCGGCCTCCGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGG
HKR374882 RBd37D10 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR378502 RBd46E06 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR385210 RBd63A10 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR394481 RBd86D09 pGCAP10 NM_138391.4  
TGGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCT
HKR402924 RBdS007F04 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR405487 RBdS013L23 pGCAP10 NM_138391.4  
GGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTC
HKR406097 RBdS015E01 pGCAP10 NM_138391.4  
GGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCTCTCCGG
HKR474888 RBdS187D16 pGCAP10 NM_138391.4  
TGCCGGTGTGGGATGGCCGCGGAGCCGGGCGGAGCTGGCTTGCGGCTCCCGGGGCCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl