Prev. |  KEGG KO K07560 > 

RIKEN DNA Bank Human Resource - DTD1

Gene ID NCBI Gene 92675 |  KEGG hsa:92675
Gene Symbol DTD1
Protein Name D-aminoacyl-tRNA deacylase 1
Synonyms C20orf88|DTD|DUE-B|DUEB|HARS2|pqn-68
Ortholog resource in our bank

  DTD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030549 IRAK076G05 pBluescriptR BC045167 NM_080820 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067629 ARe69B05 pKA1U5 NM_080820.4  
GCCCAGCCGCCGCCATGAAGGCCGTGGTGCAGCGCGTCACCCGGGCCAGCGTCACAGTTG
HKR334455 RBb36C07 pGCAP1 NM_080820.4  
GGCCGCCCCACTCGCCCCAGCCGCCGCCATGAAGGCCGTGGTGCAGCGCGTCACCCGGGC
HKR344427 RBb61B03 pGCAP1 NM_080820.4  
GACTCGCCCCAGCCGCCGCCATGAAGGCCGTGGTGCAGCGCGTCACCCGGGCCAGCGTCA
HKR364545 RBd11G01 pGCAP10 NM_080820.4  
GACTCGCCCCAGCCGCCGCCATGAAGGCCGTGGTGCAGCGCGTCACCCGGGCCAGCGTCA
HKR430382 RBdS075P22 pGCAP10 NM_080820.4  
GAGAGTCGCGAGGCCGGACGCAGCGCGGCGCCGCCCCACTCGCCCCAGCCGCCGCCATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl