Prev. | 

RIKEN DNA Bank Human Resource - MAFG-DT

Gene ID NCBI Gene 92659 |  KEGG hsa:92659
Gene Symbol MAFG-DT
Protein Name MAFG divergent transcript
Synonyms MAFG-AS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX034852 IRAK087C04 pCMV-SPORT6 BC038198
HGX035665 IRAK089C17 pCMV-SPORT6 BC046361
HGX053678 IRAK134D06 pCMV-SPORT6 BC063671
HGY090301 IRAL025M13 pOTB7 BC009233

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378408 RBd46A08 pGCAP10 NR_015454.1  
GACCCCGAGCTGCCCAGGCCCTTCCTGCGCCACGTGTACCCAGAGCTCCGCCCGGGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl