Prev. |  KEGG KO K17496 > 

RIKEN DNA Bank Human Resource - TIMM50

Gene ID NCBI Gene 92609 |  KEGG hsa:92609
Gene Symbol TIMM50
Protein Name translocase of inner mitochondrial membrane 50
Synonyms MGCA9|TIM50|TIM50L
Ortholog resource in our bank

  TIMM50

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036522 IRAK091F02 pBluescript BC050082 NM_001001563 Partial
HGX005376 IRAK013H08 pCMV-SPORT6 BC009072 NM_001001563 Partial
HGX005905 IRAK014M17 pCMV-SPORT6 BC010736 NM_001001563 Partial
HGX008412 IRAK021A12 pCMV-SPORT6 BC014674 NM_001001563 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052547 ARe31G03 pKA1U5 NM_001001563.1  
GGCGCTTGCGAAGCGGGCTCCGGCTCGGCTCGCGGGGACTGTGCACGAGGTTGGCGACGC
HKR322552 RBb06G08 pKA1U5 NM_001001563.1  
GGGCTCGGCTCGCGGGGACTGTGCACGAGGTTGGCGACGCCGCCCCGCCGGGCCCCAGAT
HKR339322 RBb48F02 pGCAP1 NM_001001563.1  
GGTGGCGTCAGCGCAAGATGGCGGCCTCGGCAGCGGTGTTCTCGCGCTTGCGAAGCGGGC
HKR348931 RBb72F11 pGCAP1 NM_001001563.1  
TGGGCGTCAGCGCAAGATGGCGGCCTCGGCAGCGGTGTTCTCGCGCTTGCGAAGCGGGCT
HKR406098 RBdS015E02 pGCAP10 NM_001001563.1  
GGCTTGCGAAGCGGGCTCCGGCTCGGCTCGCGGGGACTGTGCACGAGGTTGGCGACGCCG
HKR408981 RBdS022H13 pGCAP10 NM_001001563.1  
GAGCGCAAGATGGCGGCCTCGGCAGCGGTGTTCTCGCGCTTGCGAAGCGGGCTCCGGCTC
HKR474866 RBdS187C18 pGCAP10 NM_001001563.1  
GGGTGTTCTCGCGCTTGCGAAGCGGGCTCCGGCTCGGCTCGCGGGGACTGTGCACGAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl