Prev. | 

RIKEN DNA Bank Human Resource - SPECC1

Gene ID NCBI Gene 92521 |  KEGG hsa:92521
Gene Symbol SPECC1
Protein Name sperm antigen with calponin homology and coiled-coil domains 1
Synonyms CYTSB|HCMOGT-1|HCMOGT1|NSP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04807 SEREX clone NGO-Pr-165 (ID 2518) #1 SEREX clone NGO-Pr-165 (ID 2518) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025634 IRAK064B10 pCMV-SPORT6 BC033618 NM_152904 Partial/var
HGY036527 IRAK091F07 pBluescript BC050058 NM_001033554 Full/var
HGY096048 IRAL040B24 pOTB7 BC021123 NM_001033555 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161347 ARi03G03 pGCAP10 NM_152904.3  
GCCTTTCTTTGACTGGAGCGGACCCGCCGGACGCAACCGCCTCGCCAGCCGGAGCCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl