Prev. |  KEGG KO K19399 > 

RIKEN DNA Bank Human Resource - BBIP1

Gene ID NCBI Gene 92482 |  KEGG hsa:92482
Gene Symbol BBIP1
Protein Name BBSome interacting protein 1
Synonyms BBIP10|BBS18|NCRNA00081|bA348N5.3
Ortholog resource in our bank

  BBIP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008197 IRAK020I05 pCMV-SPORT6 BC015550
HGX069778 IRAK174H10 pCMV-SPORT6 BC073157
HGY100577 IRAL051H09 pDNR-LIB BC062778 NM_001195307.2

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059258 ARe48C10 pKA1U5 NR_015402.1  
GGTAGATTTTTTTCCTTCGCCAGTCTCACCGTTACCCGGGGCAACAGCTGAGCCGTCTGG
HKR218289 ARiS045M01 pGCAP10 NR_015402.1  
GACCCGGGGCAACAGCTGAGCCGTCTGGGAAGGGATGCATCTTTTCTTCTGTATGCTTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl