Prev. | 

RIKEN DNA Bank Human Resource - RBM18

Gene ID NCBI Gene 92400 |  KEGG hsa:92400
Gene Symbol RBM18
Protein Name RNA binding motif protein 18
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081115 IRAL002N03 pOTB7 BC008942 NM_033117
HGY083639 IRAL009B15 pOTB7 BC019319 NM_033117 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179229 ARi48B05 pGCAP10 NM_033117.2  
TGCTGGCAGCTGGCGGCATTGAGGCGGACGCGTCTAGAGGTCCGTCTGACCGCGGCGTCG
HKR279346 ARiS198G02 pGCAP10 NM_033117.2  
GGGCGGCNNNGAGGCGGNNGCGTCTAGAGGTCCGTCTTGNNNGCGGCGTCGGGACCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl