Prev. |  KEGG KO K02838 > 

RIKEN DNA Bank Human Resource - MRRF

Gene ID NCBI Gene 92399 |  KEGG hsa:92399
Gene Symbol MRRF
Protein Name mitochondrial ribosome recycling factor
Synonyms MRFF|MTRRF|RRF
Ortholog resource in our bank

  MRRF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008760 IRAK021O24 pCMV-SPORT6 BC013049 NM_138777 Full
HGY084892 IRAL012D20 pOTB7 BC002814 NM_138777 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171254 ARi28C06 pGCAP10 NM_138777.2  
GCTTAGTAACCTGGGCGATAGCTGTGGATGTTTCCAAGGATTGTCTTCAGTCATGGCCTT
HKR420415 RBdS051A15 pGCAP10 NM_138777.2  
GGCCGCCGTCGCACGAGTCTTTCCTTAGTAACCTGGGCGATAGCTGTGGATGTTTCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl