Prev. |  KEGG KO K16501 > 

RIKEN DNA Bank Human Resource - CDHR1

Gene ID NCBI Gene 92211 |  KEGG hsa:92211
Gene Symbol CDHR1
Protein Name cadherin related family member 1
Synonyms CORD15|PCDH21|PRCAD|RP65
Ortholog resource in our bank

  CDHR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031501 IRAK078M13 pCMV-SPORT6 BC038799 NM_033100 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094036 M01C035B12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094084 M01C035D12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094132 M01C035F12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094180 M01C035H12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094228 M01C035J12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094276 M01C035L12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094324 M01C035N12 pDONR221 MGC07-D06 BC038799 ENST00000372119  
HGE094372 M01C035P12 pDONR221 MGC07-D06 BC038799 ENST00000372119  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442055 RBdS105C07 pGCAP10 NM_033100.4 full cds  
GCCCGCCGCGGCTGCAGTCGCCGCTACCCCCATTGTGGTCTCTGCCCTCCCCGCGGGCCC
HKR453037 RBdS132J21 pGCAP10 NM_033100.4 full cds  
GAGTCGCCGCTACCCCCATTGTGGTCTCTGCCCTCCCCGCGGGCCCAGGGCATGCTCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl