Prev. | 

RIKEN DNA Bank Human Resource - UBTD2

Gene ID NCBI Gene 92181 |  KEGG hsa:92181
Gene Symbol UBTD2
Protein Name ubiquitin domain containing 2
Synonyms DCUBP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016830 IRAK042B06 pCMV-SPORT6 BC019910 NM_152277 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078830 ARe97B06 pKA1U5 NM_152277.2  
GGGAGCTCGGCGGTGGCGCCGGAGGAGGCTGCAGCGGCGGCGGCGGCGGGCCCGGACGAG
HKR348106 RBb70E10 pGCAP1 NM_152277.2  
GGGTGGCGCCGGAGGAGGCTGCAGCGGCGGCGGCGGCGGGCCCGGACGAGCGTCCGGAGG
HKR378483 RBd46D11 pGCAP10 NM_152277.2  
GGGTGGCGCCGGAGGAGGCTGCAGCGGCGGCGGCGGCGGGCCCGGACGAGCGTCCGGAGG
HKR395754 RBd89G10 pGCAP10 NM_152277.2  
GGGTGGCGCCGGAGGAGGCTGCAGCGGCGGCGGCGGCGAGCCCGGACGAGCGTCCGGAGG
HKR475144 RBdS187O08 pGCAP10 NM_152277.2  
GGGGCGGGCCGGGCCGAGCCCAGGCCGTGGGTGCGGAGGGCGGCGCCGCGGGCCGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl