Prev. |  KEGG KO K19828 > 

RIKEN DNA Bank Human Resource - MTG1

Gene ID NCBI Gene 92170 |  KEGG hsa:92170
Gene Symbol MTG1
Protein Name mitochondrial ribosome associated GTPase 1
Synonyms GTP|GTPBP7
Ortholog resource in our bank

  MTG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001230 IRAK003B06 pCMV-SPORT6 BC000920 NM_138384 Partial/var
HGX031718 IRAK079E22 pCMV-SPORT6 BC035721 NM_138384 Full/var
HGY085474 IRAL013L10 pOTB7 BC004409 NM_138384 Full/var
HGY097182 IRAL042P22 pOTB7 BC026039 NM_138384 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428071 RBdS070C23 pGCAP10 NM_138384.2  
GGCGCTGGTTCCCGGGCCACATGGCCAAGGGGCTGAAGAAGATGCAGAGCAGCCTGAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl