Prev. | 

RIKEN DNA Bank Human Resource - MTDH

Gene ID NCBI Gene 92140 |  KEGG hsa:92140
Gene Symbol MTDH
Protein Name metadherin
Synonyms 3D3|AEG-1|AEG1|LYRIC|LYRIC/3D3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030845 IRAK077B21 pBluescriptR BC045642 NM_178812
HGY081256 IRAL003C08 pOTB7 BC001815 NM_178812 Partial/var
HGY090516 IRAL026E20 pOTB7 BC009324 NM_178812 Partial
HGY093049 IRAL032K09 pDNR-LIB BC023994 NM_178812 Partial/var
HGY097135 IRAL042N23 pOTB7 BC022825 NM_178812

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090829 M01C027B05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE090877 M01C027D05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE090925 M01C027F05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE090973 M01C027H05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE091021 M01C027J05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE091069 M01C027L05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE091117 M01C027N05 pDONR221 MGC03-C03 BC045642 ENST00000336273  
HGE091165 M01C027P05 pDONR221 MGC03-C03 BC045642 ENST00000336273  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015738 W01A039F18 pENTR-TOPO IRAK077B21 BC045642 NM_178812  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR420623 RBdS051J07 pGCAP10 NM_178812.3  
GGGCGCCCACGTGACCCACGGTCGTCCCCGCGCGCGGCGTGGATCGCGGCCCAAGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl