Prev. | 

RIKEN DNA Bank Human Resource - DSEL

Gene ID NCBI Gene 92126 |  KEGG hsa:92126
Gene Symbol DSEL
Protein Name dermatan sulfate epimerase like
Synonyms C18orf4|DE-epi2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY100362 IRAL050P02 pOTB7 BC062557 NM_032160 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE121242 M01C103B18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121290 M01C103D18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121338 M01C103F18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121386 M01C103H18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121434 M01C103J18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121482 M01C103L18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121530 M01C103N18 pDONR221 06_12-D09 AK021849 NM_032160  
HGE121578 M01C103P18 pDONR221 06_12-D09 AK021849 NM_032160  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063660 ARe59C12 pKA1U5 NM_032160.2  
GGCCGGCCCGCGTCGCCGTCTCTCACCCTCCCCGGGCTGCGCGGCCGGAGCTGGCACAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl