Prev. |  KEGG KO K13141 > 

RIKEN DNA Bank Human Resource - INTS4

Gene ID NCBI Gene 92105 |  KEGG hsa:92105
Gene Symbol INTS4
Protein Name integrator complex subunit 4
Synonyms INT4|MST093
Ortholog resource in our bank

  INTS4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087050 IRAL017K10 pOTB7 BC006369 NM_033547 Partial
HGY089394 IRAL023I02 pOTB7 BC008013 NM_033547 Partial
HGY090059 IRAL025C11 pOTB7 BC009859 NM_033547 Partial
HGY090628 IRAL026J12 pOTB7 BC009995 NM_033547 Partial/var
HGY093233 IRAL033B09 pOTB7 BC015664 NM_033547 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE123601 M01C109A01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123649 M01C109C01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123697 M01C109E01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123745 M01C109G01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123793 M01C109I01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123841 M01C109K01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123889 M01C109M01 pDONR221 06_15-A01 BC015664 NM_033547  
HGE123937 M01C109O01 pDONR221 06_15-A01 BC015664 NM_033547  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234294 ARiS085M06 pGCAP10 NM_033547.3  
AGCTGAGAGGGCCCGCGGGTAGGCATGGCGGCGCACCTTAAGAAGCGGGTTTATGAGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl