Prev. | 

RIKEN DNA Bank Human Resource - CCNQ

Gene ID NCBI Gene 92002 |  KEGG hsa:92002
Gene Symbol CCNQ
Protein Name cyclin Q
Synonyms CycM|FAM58A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083479 IRAL008L15 pOTB7 BC001909 NM_152274 Full
HGY089089 IRAL022M01 pOTB7 BC007232 NM_152274 Full/var
HGY095698 IRAL039E02 pOTB7 BC032121 NM_152274
HGY103374 IRAL058H06 pOTB7 BC071851 NM_152274 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE088414 M01C021A14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088462 M01C021C14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088510 M01C021E14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088558 M01C021G14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088606 M01C021I14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088654 M01C021K14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088702 M01C021M14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE088750 M01C021O14 pDONR221 IMS03-B07 BC001909 ENST00000370173  
HGE097612 M01C044A12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097660 M01C044C12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097708 M01C044E12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097756 M01C044G12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097804 M01C044I12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097852 M01C044K12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097900 M01C044M12 pDONR221 MGC11-F06 BC001909 ENST00000370173  
HGE097948 M01C044O12 pDONR221 MGC11-F06 BC001909 ENST00000370173  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205584 ARiS013P24 pGCAP10 NM_152274.3  
GGCGCGCCGGGGCCGCCTCTCCTTCCGCCGGTGCCGCGGCGCCTCATGGAAGCCCCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl