Prev. |  KEGG KO K16581 > 

RIKEN DNA Bank Human Resource - TPGS1

Gene ID NCBI Gene 91978 |  KEGG hsa:91978
Gene Symbol TPGS1
Protein Name tubulin polyglutamylase complex subunit 1
Synonyms C19orf20|GTRGEO22|PGs1
Ortholog resource in our bank

  TPGS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085280 IRAL013D08 pOTB7 BC009520 NM_033513 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117226 M01C093B02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117274 M01C093D02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117322 M01C093F02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117370 M01C093H02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117418 M01C093J02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117466 M01C093L02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117514 M01C093N02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117562 M01C093P02 pDONR221 IMS10-D01 AK126170 NM_033513  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238444 ARiS096B20 pGCAP10 NM_033513.2  
GAGCGAANATGGCGGCAGTGGAGAAGCGGCGGCAAGCGGTACCACCGCCGGCCGGTTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl