Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TPGS1

Gene ID (NCBI) 91978
Gene Symbol TPGS1
Protein Name tubulin polyglutamylase complex subunit 1
Synonyms C19orf20|GTRGEO22|PGs1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K16581)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085280 IRAL013D08 pOTB7 BC009520 NM_033513 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE117226 M01C093B02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117274 M01C093D02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117322 M01C093F02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117370 M01C093H02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117418 M01C093J02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117466 M01C093L02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117514 M01C093N02 pDONR221 IMS10-D01 AK126170 NM_033513  
HGE117562 M01C093P02 pDONR221 IMS10-D01 AK126170 NM_033513  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238444 ARiS096B20 pGCAP10 NM_033513.2  
GAGCGAANATGGCGGCAGTGGAGAAGCGGCGGCAAGCGGTACCACCGCCGGCCGGTTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl