Prev. |  KEGG KO K15053 > 

RIKEN DNA Bank Human Resource - CHMP7

Gene ID NCBI Gene 91782 |  KEGG hsa:91782
Gene Symbol CHMP7
Protein Name charged multivesicular body protein 7
Synonyms -
Featured content Endocytosis (human)
Ortholog resource in our bank

  CHMP7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085414 IRAL013I22 pOTB7 BC004344 NM_152272 Partial
HGY095976 IRAL039P16 pOTB7 BC019110 NM_152272 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR019275 ARa48D03 pKA1U5 NM_152272.3  
GGGGAACGAGGGCGGAAGCGGACCAGGGCCAGGCTTGTGTTCGCAGCCTTGCCGGGGCTG
HKR383723 RBd59F03 pGCAP10 NM_152272.3  
GAGGCTTGTGTTCGCAGCCTTGCCGTGGCTGGGGTTCCGATGTGGTCCCCGGAGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl