Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CHMP7

Gene ID (NCBI) 91782
Gene Symbol CHMP7
Protein Name charged multivesicular body protein 7
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085414 IRAL013I22 pOTB7 BC004344 NM_152272 Partial
HGY095976 IRAL039P16 pOTB7 BC019110 NM_152272 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR019275 ARa48D03 pKA1U5 NM_152272.3  
GGGGAACGAGGGCGGAAGCGGACCAGGGCCAGGCTTGTGTTCGCAGCCTTGCCGGGGCTG
HKR383723 RBd59F03 pGCAP10 NM_152272.3  
GAGGCTTGTGTTCGCAGCCTTGCCGTGGCTGGGGTTCCGATGTGGTCCCCGGAGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl