Prev. | 

RIKEN DNA Bank Human Resource - DEPDC7

Gene ID NCBI Gene 91614 |  KEGG hsa:91614
Gene Symbol DEPDC7
Protein Name DEP domain containing 7
Synonyms TR2|dJ85M6.4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096430 IRAL041B06 pDNR-LIB BC030970 NM_139160 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208262 ARiS020K22 pGCAP10 NM_139160.2  
GGCTGTNNAGCTGCTGGAGGAGTTGGCGTCCGGGGAGCAAGGGCCATGGCCACCGTGCAG
HKR371633 RBd29B09 pGCAP10 NM_139160.2  
GAGCTGCTGGAGGAGTTGGCGTCCGGGGAGCAAGGGCCATGGCCACCGTGCAGGAGAAGG
HKR462448 RBdS156B24 pGCAP10 NM_139160.2  
GAGGGAGCCACGCCCCGCACAGTTAACAGACGGGCGCTCAGGGAGCTAGGGAGCTGTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl