Prev. | 

RIKEN DNA Bank Human Resource - CHURC1

Gene ID NCBI Gene 91612 |  KEGG hsa:91612
Gene Symbol CHURC1
Protein Name churchill domain containing 1
Synonyms C14orf52|My015|chch
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008062 IRAK020C14 pCMV-SPORT6 BC020550 NM_145165 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171745 ARi29G01 pGCAP10 NM_145165.2  
GCCTGTTGACTGCGTCGCGATGTGTGGCGACTGTGTGGAGAAGGAATATCCCAACCGGGG
HKR336077 RBb40D05 pGCAP1 NM_145165.2  
GCCCGGAAGCGTTGGAGGACATTCCCTGTTTGACTGCGTCGCGATGTGTGGCGACTGTGT
HKR339282 RBb48D10 pGCAP1 NM_145165.2  
AGTTCTCGCGAGGTTTCGTCTTCCCGGAAGCGTTGGAGGACATTCCCTGNTTGACTGCGT
HKR380007 RBd50A07 pGCAP10 NM_145165.2  
GGGAAGCGTTGGAGGACATTCCCTGTTGACTGCGTCGCGATGTGTGGCGACTGTGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl