Prev. |  KEGG KO K13104 > 

RIKEN DNA Bank Human Resource - ZNF830

Gene ID NCBI Gene 91603 |  KEGG hsa:91603
Gene Symbol ZNF830
Protein Name zinc finger protein 830
Synonyms CCDC16|OMCG1
Ortholog resource in our bank

  ZNF830

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005209 IRAK013A09 pCMV-SPORT6 BC009044 NM_052857 Partial
HGY086010 IRAL015A10 pOTB7 BC002913 NM_052857 Partial/var
HGY091805 IRAL029I13 pOTB7 BC011584 NM_052857 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276705 ARiS191M17 pGCAP10 NM_052857.3  
GAGAATCGTTTTGGGTCTGGTCGCCAAGATGGCGTCCTCCGCCTCCGCCCGGACTCCGGC
HKR388849 RBd72C01 pGCAP10 NM_052857.3  
GGGGTCTGGTCGCCAAGATGGCGTCCTCCGCCTCCGCCCGGACTCCGGCAGGGAAGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl