Prev. | 

RIKEN DNA Bank Human Resource - CDKN2AIPNL

Gene ID NCBI Gene 91368 |  KEGG hsa:91368
Gene Symbol CDKN2AIPNL
Protein Name CDKN2A interacting protein N-terminal like
Synonyms C2AIL
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012865 IRAK032C17 pBluescriptR BC018086 NM_080656 Partial
HGY087340 IRAL018F20 pOTB7 BC008293 NM_080656

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098827 M01C047B03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE098875 M01C047D03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE098923 M01C047F03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE098971 M01C047H03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE099019 M01C047J03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE099067 M01C047L03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE099115 M01C047N03 pDONR221 MGC13-C02 BC008293 NM_080656  
HGE099163 M01C047P03 pDONR221 MGC13-C02 BC008293 NM_080656  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205437 ARiS013J21 pGCAP10 NM_080656.1  
TGATCCGGTCCTCGGCTGCGGCGGGCACCATGGTCGGTGGCGAGGCGGCTGCCGCANTGG
HKR325354 RBb13G10 pKA1U5 NM_080656.1  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl