Prev. | 

RIKEN DNA Bank Human Resource - LMF2

Gene ID NCBI Gene 91289 |  KEGG hsa:91289
Gene Symbol LMF2
Protein Name lipase maturation factor 2
Synonyms TMEM112B|TMEM153
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086302 IRAL015M14 pOTB7 BC002942 NM_033200 Partial
HGY091729 IRAL029F09 pOTB7 BC014652 NM_033200
HGY096270 IRAL040L06 pOTB7 BC021143 NM_033200 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100419 M01C051A19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100467 M01C051C19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100515 M01C051E19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100563 M01C051G19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100611 M01C051I19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100659 M01C051K19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100707 M01C051M19 pDONR221 MGC15-A10 BC014652 ENST00000216080  
HGE100755 M01C051O19 pDONR221 MGC15-A10 BC014652 ENST00000216080  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050006 ARe25A06 pKA1U5 NM_033200.2  
GCTGCTCTAGCGGGCCGCGTAGCGGACATGGCGGGCTCCCGGCTCCCGCGGCAGCTCTTC
HKR076108 ARe90E12 pKA1U5 NM_033200.2  
GGCCCTGCTCTAGCGGGCCGCGTAGCGGACATGGCGGGCTCCCGGCTCCCGCGGCAGCTC
HKR384548 RBd61G04 pGCAP10 NM_033200.2  
GGGACGCGGAGGGCGGGCCCTGCTCTAGCGGGCCGCGTAGCGGACATGGCGGGCTCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl