Prev. |  KEGG KO K14719 > 

RIKEN DNA Bank Human Resource - SLC39A13

Gene ID NCBI Gene 91252 |  KEGG hsa:91252
Gene Symbol SLC39A13
Protein Name solute carrier family 39 member 13
Synonyms EDSSPD3|LZT-Hs9|SCDEDS|ZIP13
Ortholog resource in our bank

  SLC39A13

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090403 IRAL026A03 pOTB7 BC008853 NM_152264 Full/var
HGY092031 IRAL030B07 pOTB7 BC019016 NM_152264

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166928 ARi17F08 pGCAP10 NM_152264.3  
GGCCGCCGCCGCCGCCGCACGTACGTGGCATGCCTGGATGTCCCTGCCCTGGCTGTGGCA
HKR185649 ARi64C01 pGCAP10 NM_152264.3  
HKR243900 ARiS109M12 pGCAP10 NM_152264.3  
GGGGCGGGGCGCGGCACCGCAGCTGGATGGCTGGGGCCGCCCGGATCGCCGCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl