Prev. |  KEGG KO K08869 > 

RIKEN DNA Bank Human Resource - ADCK2

Gene ID NCBI Gene 90956 |  KEGG hsa:90956
Gene Symbol ADCK2
Protein Name aarF domain containing kinase 2
Synonyms AARF
Ortholog resources KEGG ortholog (KEGG orthology K08869) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092053 IRAL030C05 pOTB7 BC014107 NM_052853 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042083 ARe05D11 pKA1U5 NM_052853.3  
GGAGGCCCGGCGAGGTGCTGGAGGGAGCGGGGCGCGGATCCGGCCCAGATGGGCAGCTCC
HKR432410 RBdS081A10 pGCAP10 NM_052853.3  
GGCGCCCTGGGCTGGTGCCCGCCACCCCAGCGATCTCATACTGGCCCCTGGGCGCACGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl