Prev. | 

RIKEN DNA Bank Human Resource - DMAC1

Gene ID NCBI Gene 90871 |  KEGG hsa:90871
Gene Symbol DMAC1
Protein Name distal membrane arm assembly complex 1
Synonyms C9orf123|TMEM261
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084598 IRAL011I06 pOTB7 BC009510 NM_033428 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322450 RBb06C02 pKA1U5 NM_033428.1  
GGAACCAAAGACGCCCAAGGGTTGAGGCCGAGTTCCAGAGCATGGGGTCTCGGTTGTCCC
HKR336450 RBb41C02 pGCAP1 NM_033428.1  
GGTCGTTTACGCCAGTTTGAACCAAAGACGCCCAAGGTTGAGGCCGAGTTCCAGAGCATG
HKR341632 RBb54B08 pGCAP1 NM_033428.1  
TGGACGCCCAAGGGTTGAGGCCGAGTTCCAGAGCATGGGGTCTCGGTTGTCCCAGCCTTT
HKR363356 RBd08G12 pGCAP10 NM_033428.1  
GGTTTACGCCAGTTTGAACCAAAGACGCCCAAGGTTGAGGCCGAGTTCCAGAGCATGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl