Prev. |  KEGG KO K10345 > 

RIKEN DNA Bank Human Resource - SPSB3

Gene ID NCBI Gene 90864 |  KEGG hsa:90864
Gene Symbol SPSB3
Protein Name splA/ryanodine receptor domain and SOCS box containing 3
Synonyms C16orf31|SSB3
Ortholog resource in our bank

  SPSB3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018426 IRAK046B02 pBluescriptR BC024244 NM_080861 Full/var
HGY029248 IRAK073B24 pBluescriptR BC035065 NM_080861 Full/var
HGY036690 IRAK091M02 pBluescript BC047441 NM_080861 Full/var
HGY089023 IRAL022J07 pOTB7 BC007588 NM_080861 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050084 ARe25D12 pKA1U5 NM_080861.3  
GACGTCTCGCTCCGGGGCGGAAAGTGGGTCAGGGCCGGGCCGGCGGAGCGCGCAGCGGGG
HKR347374 RBb68H06 pGCAP1 NM_080861.3  
GGGGGGCTGCAGATTCTTTCCACCATGGCCAGACGCCCCCGGAACAGCAGGGCCTGGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl