Prev. | 

RIKEN DNA Bank Human Resource - ZNF598

Gene ID NCBI Gene 90850 |  KEGG hsa:90850
Gene Symbol ZNF598
Protein Name zinc finger protein 598
Synonyms HEL2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020825 IRAK052B01 pCMV-SPORT6 BC029270 NM_178167 Partial
HGX039424 IRAK098J08 pCMV-SPORT6 BC050477 NM_178167
HGY090114 IRAL025E18 pOTB7 BC010990 NM_178167 Partial/var
HGY097601 IRAL044A01 pOTB7 BC041015 NM_178167 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395630 RBd89B06 pGCAP10 NM_178167.2  
GGGAAGGGGCGGGCCCGCCGGGAGCCAGGCCGCGCGGCGCCGCGCCGGCCGAGAGGGGGC
HKR453110 RBdS132M22 pGCAP10 NM_178167.2  
GGCCGGATCCCGGACCATGGCGGCGGCGGGGGGCGCCGAGGGGCGGCGCGCGGCCCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl